File Download

There are no files associated with this item.

  Links for fulltext
     (May Require Subscription)

Article: An oligonucleotide probe for the detection of hepatitis B virus DNA in serum

TitleAn oligonucleotide probe for the detection of hepatitis B virus DNA in serum
Keywords3'-End labelling
DNA probe
Molecular hybridization
Oligonucleotide probe
Serum hepatitis B virus DNA
Issue Date1987
PublisherElsevier BV. The Journal's web site is located at
Journal Of Virological Methods, 1987, v. 15 n. 2, p. 139-149 How to Cite?
AbstractA novel and practical assay for the detection of hepatitis B virus (HBV) DNA in serum is described that utilizes as probe a 21-nucleotide sequence 5'-d(CTTCGCTTCACCTCTGCACGT) labelled at the 3'-end with [ 32P]ddAMP. The oligonucleotide probe sequence occurs in all known HBV genomes and is complementary to a region near the end of the single-stranded gap. It includes the 11-nucleotide direct repeat 5'-d(TTCACCTCTGC). The method was tested on 988 serum HBsAg-positive or -negative specimens and compared to results with HBV DNA probe, with over 98% concordance between the methods. The sensitivity of the two assays were comparable. The assay was developed for testing serum samples fixed to nylon or nitrocellulose membranes. Hybridization time could be shortened to a few hours as compared to 16 h for HBV DNA probes. Immaculate backgrounds were obtained by using a hybridization medium containing polyethylene glycol, heparin and pyrophosphate, and a particular washing procedure.
Persistent Identifier
2020 Impact Factor: 2.014
2015 SCImago Journal Rankings: 0.866
ISI Accession Number ID


DC FieldValueLanguage
dc.contributor.authorLin, HJen_US
dc.contributor.authorWu, PCen_US
dc.contributor.authorLai, CLen_US
dc.identifier.citationJournal Of Virological Methods, 1987, v. 15 n. 2, p. 139-149en_US
dc.description.abstractA novel and practical assay for the detection of hepatitis B virus (HBV) DNA in serum is described that utilizes as probe a 21-nucleotide sequence 5'-d(CTTCGCTTCACCTCTGCACGT) labelled at the 3'-end with [ 32P]ddAMP. The oligonucleotide probe sequence occurs in all known HBV genomes and is complementary to a region near the end of the single-stranded gap. It includes the 11-nucleotide direct repeat 5'-d(TTCACCTCTGC). The method was tested on 988 serum HBsAg-positive or -negative specimens and compared to results with HBV DNA probe, with over 98% concordance between the methods. The sensitivity of the two assays were comparable. The assay was developed for testing serum samples fixed to nylon or nitrocellulose membranes. Hybridization time could be shortened to a few hours as compared to 16 h for HBV DNA probes. Immaculate backgrounds were obtained by using a hybridization medium containing polyethylene glycol, heparin and pyrophosphate, and a particular washing procedure.en_US
dc.publisherElsevier BV. The Journal's web site is located at
dc.relation.ispartofJournal of Virological Methodsen_US
dc.subject3'-End labelling-
dc.subjectDNA probe-
dc.subjectMolecular hybridization-
dc.subjectOligonucleotide probe-
dc.subjectSerum hepatitis B virus DNA-
dc.subject.meshDna, Viral - Blooden_US
dc.subject.meshGenes, Viralen_US
dc.subject.meshHepatitis B Virus - Genetics - Isolation & Purificationen_US
dc.subject.meshNucleic Acid Hybridizationen_US
dc.subject.meshOligodeoxyribonucleotides - Diagnostic Useen_US
dc.subject.meshSpecies Specificityen_US
dc.titleAn oligonucleotide probe for the detection of hepatitis B virus DNA in serumen_US
dc.identifier.emailLai, CL:hrmelcl@hku.hken_US
dc.identifier.authorityLai, CL=rp00314en_US
dc.identifier.scopusauthoridLin, HJ=7405571292en_US
dc.identifier.scopusauthoridWu, PC=7403119323en_US
dc.identifier.scopusauthoridLai, CL=7403086396en_US

Export via OAI-PMH Interface in XML Formats


Export to Other Non-XML Formats